Stem-loop sequence ptr-mir-3664

AccessionMI0020610 (change log)
DescriptionPan troglodytes miR-3664 stem-loop
Gene family MIPF0001518; mir-3664
Stem-loop
   cccgucucc  ug  aac                       c    g    uac   cc 
5'          uc  ua   uugaagguagggaacucugucuu acuc ugag   cuu  a
            ||  ||   ||||||||||||||||||||||| |||| ||||   |||  a
3'          ag  gu   aacuuccaucccuugagacagaa ugag acuc   gag  c
   --------u  gu  ---                       a    g    -uc   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr11: 70784711-70784819 [-]
intergenic
Database links

Mature sequence ptr-miR-3664

Accession MIMAT0024063
Sequence

71 - 

ucaggaguaaagacagagu

 - 89

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).