Stem-loop sequence ptr-mir-3132

AccessionMI0020605 (change log)
DescriptionPan troglodytes miR-3132 stem-loop
Gene family MIPF0001509; mir-3132
Stem-loop
   -----------ugau  -    ugu           u    -    a      a   ----c  u 
5'                ga ccac   ggugggauggg agag aagg gcucag gga     gg g
                  || ||||   ||||||||||| |||| |||| |||||| |||     ||  
3'                cu ggug   ccacccuacuc ucuc uucc cgaguu ccu     cc c
   cuuagaccuucggau  c    --u           -    c    -      c   uuguu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr2B: 110468799-110468909 [-]
antisense
ENSPTRT00000056075 ; TMEM198-201; 3'UTR (exon 4)
Database links

Mature sequence ptr-miR-3132

Accession MIMAT0024058
Sequence

21 - 

uggguagagaaggagcucaga

 - 41

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).