Stem-loop sequence ptr-mir-548e

AccessionMI0020604 (change log)
DescriptionPan troglodytes miR-548e stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548e
(2 sentences)

Stem-loop
   cuucugugaucuauggc              a      cau              a   c 
5'                  uuuauuagguuggu caaaag   ucgcgguuuuugcu uua u
                    |||||||||||||| ||||||   |||||||||||||| |||  
3'                  agauaguccaacca guuuuc   agcgucaaaaacgg aau u
   --------------aga              c      auc              a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr10: 112595886-112595993 [+]
sense
ENSPTRT00000005608 ; SHOC2-201; intron 3
Database links

Mature sequence ptr-miR-548e

Accession MIMAT0024057
Sequence

71 - 

aaaaacugcgacuacuuuug

 - 90

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).