Stem-loop sequence ptr-mir-548o

AccessionMI0020601 (change log)
DescriptionPan troglodytes miR-548o stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548o
(2 sentences)

Stem-loop
   uaucguuucu     aauau    auu                       u   --    a 
5'           augua     uuag   ggugcaaaaguaauugcgguuuu gcc  auua a
             |||||     ||||   ||||||||||||||||||||||| |||  ||||  
3'           uacau     aauc   ccacguuuucauugacgucaaaa cgg  uaau a
   ------aaac     -----    cac                       c   cg    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr20: 40058768-40058878 [+]
sense
ENSPTRT00000025094 ; RALGAPB-201; intron 7
Database links

Mature sequence ptr-miR-548o

Accession MIMAT0024054
Sequence

33 - 

aaaaguaauugcgguuuuugcc

 - 54

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).