Stem-loop sequence ptr-mir-767

AccessionMI0020579 (change log)
DescriptionPan troglodytes miR-767 stem-loop
Gene family MIPF0000552; mir-767
Stem-loop
   ---------------   u  u             u c       uu  c      u    c 
5'                aua ug agguuuuugcuca g accaugg  gu ugagca gcag a
                  ||| || ||||||||||||| | |||||||  || |||||| |||| u
3'                ugu ac uccaaggacgagu u ugguacc  ca acucgu uguu g
   ggacauuucgucauc   u  u             c u       -c  u      c    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chrX: 152096905-152097015 [-]
sense
ENSPTRT00000073600 ; ptr-mir-767-201; exon 1
KV421455.1: 441367-441477 [+]
sense
ENSPTRT00000073600 ; ptr-mir-767-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-767
ptr-mir-105chrX: 152097904-152097984 [-]
ptr-mir-767chrX: 152096905-152097015 [-]
Database links

Mature sequence ptr-miR-767

Accession MIMAT0024032
Sequence

21 - 

ugcaccaugguugucugagca

 - 41

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).