Stem-loop sequence ptr-mir-320e

AccessionMI0020577 (change log)
DescriptionPan troglodytes miR-320e stem-loop
Gene family MIPF0000163; mir-320
Stem-loop
   ucaaaaaaaugaaaagaaaagaaaauaccuccauggg        uu       c     g   
5'                                      gccuucuc  cccaguu uuccu ga 
                                        ||||||||  ||||||| ||||| | g
3'                                      uggaagag  gggucga aaggg cu 
   ---------------aguuccaaacaaaaaagaaaag        uu       a     g   
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 48828922-48829033 [-]
sense
ENSPTRT00000020797 ; PRKD2-201; intron 2
Database links

Mature sequence ptr-miR-320e

Accession MIMAT0024030
Sequence

71 - 

aaaagcuggguugagaagguga

 - 92

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).