Stem-loop sequence cgr-mir-93

AccessionMI0020562 (change log)
DescriptionCricetulus griseus miR-93 stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention cgr-mir-93
(1 sentences)

Stem-loop
   -a         -ca       -     u    g   u  aau 
5'   ugggggcuc   aagugcu guucg gcag uag gu   u
     |||||||||   ||||||| ||||| |||| ||| ||   a
3'   acccccgag   uucacga cgagu cguc auc ca   c
   gg         ccc       u     -    -   -  guc 
Get sequence
Deep sequencing
645567 reads, 8.23e+03 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH001296.1: 178880-178960 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-93
cgr-mir-106bJH001296.1: 179099-179179 [-]
cgr-mir-93JH001296.1: 178880-178960 [-]
cgr-mir-25JH001296.1: 178664-178762 [-]
Database links

Mature sequence cgr-miR-93-5p

Accession MIMAT0024013
Sequence

11 - 

caaagugcuguucgugcagguag

 - 33

Get sequence
Deep sequencing622439 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-93-3p

Accession MIMAT0024014
Sequence

50 - 

acugcugagcuagcacuucccga

 - 72

Get sequence
Deep sequencing1345 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).