Stem-loop sequence cgr-mir-92a

AccessionMI0020560 (change log)
DescriptionCricetulus griseus miR-92a stem-loop
Gene family MIPF0000013; mir-25
Literature search

2 open access papers mention cgr-mir-92a
(16 sentences)

Stem-loop
   ---cu   uac            uu  u          guu 
5'      uuc   acaggcugggau  gu gcaaugcugu   u
        |||   ||||||||||||  || ||||||||||    
3'      gag   uguccggcccug  ca cguuauggua   c
   gguuu   --u            uu  -          gcu 
Get sequence
Deep sequencing
510700 reads, 6.23e+03 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH001979.1: 108958-109035 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-92a
cgr-mir-17JH001979.1: 109700-109777 [-]
cgr-mir-18aJH001979.1: 109537-109639 [-]
cgr-mir-19aJH001979.1: 109407-109486 [-]
cgr-mir-20aJH001979.1: 109227-109306 [-]
cgr-mir-19bJH001979.1: 109073-109152 [-]
cgr-mir-92aJH001979.1: 108958-109035 [-]
Database links

Mature sequence cgr-miR-92a-5p

Accession MIMAT0024009
Sequence

11 - 

aggcugggauuuguugcaaugcu

 - 33

Get sequence
Deep sequencing78656 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-92a-3p

Accession MIMAT0024010
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Deep sequencing411478 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).