Stem-loop sequence cgr-mir-9

AccessionMI0020559 (change log)
DescriptionCricetulus griseus miR-9 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   ----     g   uc               g      ug a 
5'     gaguu uua  uuugguuaucuagcu uaugag  u u
       ||||| |||  ||||||||||||||| ||||||  |  
3'     cucaa aau  aagccaauagaucga auacuu  g u
   cuuc     a   ga               a      cu g 
Get sequence
Deep sequencing
18264 reads, 33.3 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000258.1: 941049-941128 [+]
intergenic
Database links

Mature sequence cgr-miR-9

Accession MIMAT0024008
Sequence

10 - 

ucuuugguuaucuagcuguaug

 - 31

Get sequence
Deep sequencing146 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).