Stem-loop sequence cgr-mir-671

AccessionMI0020549 (change log)
DescriptionCricetulus griseus miR-671 stem-loop
Gene family MIPF0000358; mir-671
Stem-loop
   -ca        a   a      ga           -u   g 
5'    ggaagagg gga gcccug  ggggcuggagg  gau g
      |||||||| ||| ||||||  |||||||||||  |||  
3'    cuuucucc ccu cgggac  ucuuggccucc  uug a
   gag        a   -      --           uu   u 
Get sequence
Deep sequencing
66008 reads, 483 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000263.1: 907955-908033 [-]
intergenic
Database links

Mature sequence cgr-miR-671-5p

Accession MIMAT0023996
Sequence

11 - 

aggaagcccuggaggggcuggagg

 - 34

Get sequence
Deep sequencing41846 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-671-3p

Accession MIMAT0023997
Sequence

50 - 

uccgguucucagggcuccacc

 - 70

Get sequence
Deep sequencing1411 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).