Stem-loop sequence cgr-mir-615

AccessionMI0020543 (change log)
DescriptionCricetulus griseus miR-615 stem-loop
Gene family MIPF0000342; mir-615
Stem-loop
   ---    c          uc     u        cu    g ug 
5'    gggg gggagggggg  cccgg gcucggau  cgag g  c
      |||| ||||||||||  ||||| ||||||||  |||| |  u
3'    cccc ccuucucccu  ggguc cgagccug  gcuu u  u
   cua    -          cu     -        --    g ua 
Get sequence
Deep sequencing
25813 reads, 16.7 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000760.1: 38218-38301 [-]
intergenic
Database links

Mature sequence cgr-miR-615-5p

Accession MIMAT0023987
Sequence

11 - 

ggggguccccggugcucggauc

 - 32

Get sequence
Deep sequencing440 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-615-3p

Accession MIMAT0023988
Sequence

54 - 

uccgagccugggucucccucuu

 - 75

Get sequence
Deep sequencing2991 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).