Stem-loop sequence cgr-mir-504

AccessionMI0020537 (change log)
DescriptionCricetulus griseus miR-504 stem-loop
Gene family MIPF0000437; mir-504
Stem-loop
   ---------------------ug    -            g     a -    a  u   a 
5'                        cugu ugggagacccug ucugc c cucu uc gua a
                          |||| |||||||||||| ||||| | |||| || |||  
3'                        gaca acccuuugggac ggacg g ggga ag cau c
   guucucuaccaucggacacggag    u            g     a a    -  u   a 
Get sequence
Deep sequencing
21156 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000262.1: 424466-424565 [-]
intergenic
Database links

Mature sequence cgr-miR-504

Accession MIMAT0023978
Sequence

11 - 

agacccuggucugcaccucuauc

 - 33

Get sequence
Deep sequencing376 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).