Stem-loop sequence cgr-mir-484

AccessionMI0020529 (change log)
DescriptionCricetulus griseus miR-484 stem-loop
Gene family MIPF0000219; mir-484
Stem-loop
   ugcagccucgucaggcucaguc  -      -au    -    a 
5'                       cc cucccg   aaac cucu a
                         || ||||||   |||| ||||  
3'                       gg gggggc   uuug ggga a
   ----------------gccucc  u      ccc    u    u 
Get sequence
Deep sequencing
19588 reads, 33.3 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000332.1: 1297236-1297306 [-]
intergenic
Database links

Mature sequence cgr-miR-484

Accession MIMAT0023966
Sequence

11 - 

ucaggcucaguccccucccgau

 - 32

Get sequence
Deep sequencing827 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).