Stem-loop sequence cgr-mir-361

AccessionMI0020509 (change log)
DescriptionCricetulus griseus miR-361 stem-loop
Gene family MIPF0000172; mir-361
Stem-loop
   -cuu      uu         --u  a    u    a  a 
5'     ggaagc  aucagaauc   cc gggg acuu uu u
       ||||||  |||||||||   || |||| |||| || u
3'     ccuuug  uagucuugg   gg cccc ugaa aa u
   ucuu      cu         ugu  a    c    a  g 
Get sequence
Deep sequencing
20473 reads, 33.3 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH001478.1: 84893-84972 [+]
intergenic
Database links

Mature sequence cgr-miR-361

Accession MIMAT0023933
Sequence

10 - 

uuaucagaaucuccagggguac

 - 31

Get sequence
Deep sequencing1510 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).