Stem-loop sequence cgr-mir-331

AccessionMI0020498 (change log)
DescriptionCricetulus griseus miR-331 stem-loop
Gene family MIPF0000199; mir-331
Stem-loop
         u        u    u       au ccaga 
5' uggguu guucuagg augg cccaggg  c     u
   |||||| |||||||| |||| |||||||  |     c
3' auccaa caagaucc uauc ggguccc  g     a
         c        -    c       cg accaa 
Get sequence
Deep sequencing
15168 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000270.1: 1491783-1491856 [-]
intergenic
Database links

Mature sequence cgr-miR-331-5p

Accession MIMAT0023916
Sequence

11 - 

cuagguauggucccagggauc

 - 31

Get sequence
Deep sequencing281 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-331-3p

Accession MIMAT0023917
Sequence

46 - 

gccccugggccuauccuaga

 - 65

Get sequence
Deep sequencing485 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).