Stem-loop sequence cgr-mir-29c

AccessionMI0020480 (change log)
DescriptionCricetulus griseus miR-29c stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --c   ggc           ucc       ---     u 
5'    aca   ugaccgauuuc   ugguguu   cagag c
      |||   |||||||||||   |||||||   ||||| u
3'    ugu   auuggcuaaag   accacga   guuuu g
   gga   agu           uuu       ucu     u 
Get sequence
Deep sequencing
340073 reads, 4.18e+03 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH002029.1: 103082-103157 [+]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-29c
cgr-mir-29b-2JH002029.1: 102547-102610 [+]
cgr-mir-29cJH002029.1: 103082-103157 [+]
Database links

Mature sequence cgr-miR-29c-5p

Accession MIMAT0023887
Sequence

10 - 

accgauuucuccugguguucaga

 - 32

Get sequence
Deep sequencing455 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-29c-3p

Accession MIMAT0023888
Sequence

46 - 

uagcaccauuugaaaucgguu

 - 66

Get sequence
Deep sequencing323993 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).