Stem-loop sequence cgr-mir-29a

AccessionMI0020478 (change log)
DescriptionCricetulus griseus miR-29a stem-loop
Gene family MIPF0000009; mir-29
Literature search

1 open access papers mention cgr-mir-29a
(1 sentences)

Stem-loop
   uuagagg            uuu       c    ucaa 
5'        augacugauuuc   ugguguu agag    u
          ||||||||||||   ||||||| ||||    a
3'        uauuggcuaaag   accacga ucuu    g
   uuaguaa            ucu       -    uuaa 
Get sequence
Deep sequencing
358500 reads, 4.27e+03 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH005876.1: 8380-8457 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-29a
cgr-mir-29bJH005876.1: 8713-8795 [-]
cgr-mir-29aJH005876.1: 8380-8457 [-]
Database links

Mature sequence cgr-miR-29a-5p

Accession MIMAT0023883
Sequence

11 - 

acugauuucuuuugguguucagag

 - 34

Get sequence
Deep sequencing9106 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-29a-3p

Accession MIMAT0023884
Sequence

49 - 

uagcaccaucugaaaucgguu

 - 69

Get sequence
Deep sequencing332154 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).