Stem-loop sequence cgr-mir-210

AccessionMI0020458 (change log)
DescriptionCricetulus griseus miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   -  cu    a     a   cc   -      c  c   gc 
5'  gg  cagg cagcc cug  cac cgcaca ug guu  u
    ||  |||| ||||| |||  ||| |||||| || |||   
3'  cc  gucu gucgg gac  gug gcgugu ac cag  c
   u  cu    a     c   -a   u      c  c   gc 
Get sequence
Deep sequencing
34920 reads, 200 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH001184.1: 77044-77122 [-]
intergenic
Database links

Mature sequence cgr-miR-210-5p

Accession MIMAT0023848
Sequence

11 - 

agccacugcccaccgcacacug

 - 32

Get sequence
Deep sequencing604 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-210-3p

Accession MIMAT0023849
Sequence

49 - 

cugugcgugugacagcggcuga

 - 70

Get sequence
Deep sequencing18563 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).