Stem-loop sequence cgr-mir-20a

AccessionMI0020457 (change log)
DescriptionCricetulus griseus miR-20a stem-loop
Gene family MIPF0000001; mir-17
Literature search

2 open access papers mention cgr-mir-20a
(2 sentences)

Stem-loop
   --u  - ug     -a       ua        g   -  uc 
5'    cu g  gcacu  aagugcu  uagugcag uag ug  c
      || |  |||||  |||||||  |||||||| ||| ||   
3'    ga c  cguga  uucacga  auuacguc auc ac  a
   guc  c gu     cc       gc        -   u  uc 
Get sequence
Deep sequencing
326666 reads, 4.1e+03 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH001979.1: 109227-109306 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-20a
cgr-mir-17JH001979.1: 109700-109777 [-]
cgr-mir-18aJH001979.1: 109537-109639 [-]
cgr-mir-19aJH001979.1: 109407-109486 [-]
cgr-mir-20aJH001979.1: 109227-109306 [-]
cgr-mir-19bJH001979.1: 109073-109152 [-]
cgr-mir-92aJH001979.1: 108958-109035 [-]
Database links

Mature sequence cgr-miR-20a

Accession MIMAT0023847
Sequence

11 - 

uaaagugcuuauagugcagguag

 - 33

Get sequence
Deep sequencing308381 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).