Stem-loop sequence cgr-mir-19b

AccessionMI0020451 (change log)
DescriptionCricetulus griseus miR-19b stem-loop
Gene family MIPF0000011; mir-19
Literature search

1 open access papers mention cgr-mir-19b
(2 sentences)

Stem-loop
   -gu                 -  -      uc    --u     
5'    cuaugguuaguuuugca gg uuugca  cagc   guau 
      ||||||||||||||||| || ||||||  ||||   ||| a
3'    ggugucagucaaaacgu cc aaacgu  gucg   caua 
   ggu                 a  u      --    ucu     
Get sequence
Deep sequencing
38614 reads, 200 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH001979.1: 109073-109152 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-19b
cgr-mir-17JH001979.1: 109700-109777 [-]
cgr-mir-18aJH001979.1: 109537-109639 [-]
cgr-mir-19aJH001979.1: 109407-109486 [-]
cgr-mir-20aJH001979.1: 109227-109306 [-]
cgr-mir-19bJH001979.1: 109073-109152 [-]
cgr-mir-92aJH001979.1: 108958-109035 [-]
Database links

Mature sequence cgr-miR-19b-5p

Accession MIMAT0023840
Sequence

11 - 

aguuuugcagguuugcauccagc

 - 33

Get sequence
Deep sequencing187 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-19b-3p

Accession MIMAT0023841
Sequence

49 - 

ugugcaaauccaugcaaaacuga

 - 71

Get sequence
Deep sequencing17616 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).