Stem-loop sequence cgr-mir-19a

AccessionMI0020450 (change log)
DescriptionCricetulus griseus miR-19a stem-loop
Gene family MIPF0000011; mir-19
Literature search

1 open access papers mention cgr-mir-19a
(1 sentences)

Stem-loop
   gca   cu                --c      u  aagaa 
5'    gcc  cuguuaguuuugcaua   uugcac ac     g
      |||  ||||||||||||||||   |||||| ||      
3'    cgg  gguagucaaaacguau   aacgug ug     a
   -uc   -u                cua      u  acgua 
Get sequence
Deep sequencing
34896 reads, 183 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH001979.1: 109407-109486 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-19a
cgr-mir-17JH001979.1: 109700-109777 [-]
cgr-mir-18aJH001979.1: 109537-109639 [-]
cgr-mir-19aJH001979.1: 109407-109486 [-]
cgr-mir-20aJH001979.1: 109227-109306 [-]
cgr-mir-19bJH001979.1: 109073-109152 [-]
cgr-mir-92aJH001979.1: 108958-109035 [-]
Database links

Mature sequence cgr-miR-19a

Accession MIMAT0023839
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Deep sequencing17276 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).