Stem-loop sequence cgr-mir-199b

AccessionMI0020449 (change log)
DescriptionCricetulus griseus miR-199b stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   cu         ---       u   a    c   u  ----  a 
5'   uccgaucuc   ccagugu uag cuac ugu ca    gg c
     |||||||||   ||||||| ||| |||| ||| ||    ||  
3'   aggcuagag   gguuaca guc gaug aca gu    cc u
   --         auu       c   c    -   u  uaaa  c 
Get sequence
Deep sequencing
39420 reads, 167 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cgr-miR-199b

Accession MIMAT0023838
Sequence

11 - 

cccaguguuuagacuaccuguuc

 - 33

Get sequence
Deep sequencing421 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).