Stem-loop sequence cgr-mir-199a

AccessionMI0020448 (change log)
DescriptionCricetulus griseus miR-199a stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   --   c   auc       u      agcuguucagcagg 
5'   ccc gcc   ccagugu cagacu              c
     ||| |||   ||||||| ||||||               
3'   ggg cgg   gguuaca gucuga              u
   gc   u   auu       c      ugacauguauagug 
Get sequence
Deep sequencing
44766 reads, 167 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000173.1: 721995-722074 [+]
intergenic
Database links

Mature sequence cgr-miR-199a-5p

Accession MIMAT0023836
Sequence

10 - 

cccaguguucagacuagcuguuc

 - 32

Get sequence
Deep sequencing2240 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-199a-3p

Accession MIMAT0023837
Sequence

50 - 

acaguagucugcacauugguu

 - 70

Get sequence
Deep sequencing23085 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).