Stem-loop sequence cgr-mir-196c

AccessionMI0020446 (change log)
DescriptionCricetulus griseus miR-196c stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   ---  -a           a   uc         - gc ugg 
5'    ug  gugaauuaggu guu  guguuguug g  c   c
      ||  ||||||||||| |||  ||||||||| |  |   u
3'    ac  cacuuagucca caa  uacagcaac c  g   u
   uug  gg           c   cc         a aa ucu 
Get sequence
Deep sequencing
897796 reads, 1.19e+04 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000166.1: 102961-103040 [+]
intergenic
Database links

Mature sequence cgr-miR-196c

Accession MIMAT0023834
Sequence

10 - 

uagguaguuucguguuguuggg

 - 31

Get sequence
Deep sequencing875991 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).