Stem-loop sequence cgr-mir-195

AccessionMI0020442 (change log)
DescriptionCricetulus griseus miR-195 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   ---     g  cu          -a         --   g g 
5'    uccug cu  agcagcacag  aauauuggc  acu g a
      ||||| ||  ||||||||||  |||||||||  ||| |  
3'    gggac ga  ucguuguguc  uuauaaccg  uga c a
   ggu     g  cc          gg         uc   g g 
Get sequence
Deep sequencing
21233 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000064.1: 2276744-2276823 [+]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-195
cgr-mir-497bJH000064.1: 2276413-2276537 [-]
cgr-mir-497JH000064.1: 2276442-2276522 [+]
cgr-mir-195JH000064.1: 2276744-2276823 [+]
Database links

Mature sequence cgr-miR-195

Accession MIMAT0023829
Sequence

10 - 

uagcagcacagaaauauuggca

 - 31

Get sequence
Deep sequencing3516 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).