Stem-loop sequence cgr-mir-18a

AccessionMI0020433 (change log)
DescriptionCricetulus griseus miR-18a stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention cgr-mir-18a
(1 sentences)

Stem-loop
   gugcu  --gu         u   --   u   uc   u    a   -  -a  u 
5'      ga    gcuuuuugu cua  agg gca  uag gcag uag ug  ag a
        ||    ||||||||| |||  ||| |||  ||| |||| ||| ||  ||  
3'      cu    ugaagaaua ggu  ucc cgu  auc cguc auc ac  uc g
   --cug  guau         c   cu   u   ga   c    -   u  ga  a 
Get sequence
Deep sequencing
46400 reads, 350 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH001979.1: 109537-109639 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-18a
cgr-mir-17JH001979.1: 109700-109777 [-]
cgr-mir-18aJH001979.1: 109537-109639 [-]
cgr-mir-19aJH001979.1: 109407-109486 [-]
cgr-mir-20aJH001979.1: 109227-109306 [-]
cgr-mir-19bJH001979.1: 109073-109152 [-]
cgr-mir-92aJH001979.1: 108958-109035 [-]
Database links

Mature sequence cgr-miR-18a-5p

Accession MIMAT0023817
Sequence

21 - 

uaaggugcaucuagugcagauag

 - 43

Get sequence
Deep sequencing26377 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-18a-3p

Accession MIMAT0023818
Sequence

62 - 

acugcccuaagugcuccuucugg

 - 84

Get sequence
Deep sequencing1723 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).