Stem-loop sequence cgr-mir-181d

AccessionMI0020423 (change log)
DescriptionCricetulus griseus miR-181d stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   ---      auca         g ug          g  auga 
5'    gucaca    acauucauu u  ucgguggguu ug    g
      ||||||    ||||||||| |  |||||||||| ||     
3'    cggugu    uguaaguag g  ggccacccag ac    g
   ggu      -cac         g --          -  cgga 
Get sequence
Deep sequencing
172985 reads, 1.8e+03 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000286.1: 1109186-1109266 [+]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-181d
cgr-mir-181cJH000286.1: 1109008-1109087 [+]
cgr-mir-181dJH000286.1: 1109186-1109266 [+]
Database links

Mature sequence cgr-miR-181d-5p

Accession MIMAT0023803
Sequence

10 - 

aacauucauuguugucggugggu

 - 32

Get sequence
Deep sequencing148729 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-181d-3p

Accession MIMAT0023804
Sequence

51 - 

cccaccgggggaugaauguca

 - 71

Get sequence
Deep sequencing77 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).