Stem-loop sequence cgr-mir-17

AccessionMI0020419 (change log)
DescriptionCricetulus griseus miR-17 stem-loop
Gene family MIPF0000001; mir-17
Literature search

3 open access papers mention cgr-mir-17
(36 sentences)

Stem-loop
   agg         -        a  g     --gua   a 
5'    auaauguca aagugcuu ca ugcag     gug u
      ||||||||| |||||||| || |||||     ||| a
3'    uauuacggu uucacgga gu acguc     cac u
   ugg         g        c  g     aucua   g 
Get sequence
Deep sequencing
343071 reads, 4.23e+03 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH001979.1: 109700-109777 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-17
cgr-mir-17JH001979.1: 109700-109777 [-]
cgr-mir-18aJH001979.1: 109537-109639 [-]
cgr-mir-19aJH001979.1: 109407-109486 [-]
cgr-mir-20aJH001979.1: 109227-109306 [-]
cgr-mir-19bJH001979.1: 109073-109152 [-]
cgr-mir-92aJH001979.1: 108958-109035 [-]
Database links

Mature sequence cgr-miR-17-5p

Accession MIMAT0023795
Sequence

11 - 

caaagugcuuacagugcagguag

 - 33

Get sequence
Deep sequencing278945 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-17-3p

Accession MIMAT0023796
Sequence

48 - 

acugcagugcaggcacuugugg

 - 69

Get sequence
Deep sequencing46387 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).