Stem-loop sequence cgr-mir-15a

AccessionMI0020416 (change log)
DescriptionCricetulus griseus miR-15a stem-loop
Gene family MIPF0000006; mir-15
Literature search

2 open access papers mention cgr-mir-15a
(5 sentences)

Stem-loop
   ---ggaguaaa ua        ua          ga  u 
5'            g  gcagcaca  augguuugug  uu u
              |  ||||||||  ||||||||||  || g
3'            c  cgucgugu  uaccggacgu  aa a
   ggaacauaaaa uc        ua          gg  a 
Get sequence
Deep sequencing
67585 reads, 633 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000694.1: 802850-802927 [+]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-15a
cgr-mir-15aJH000694.1: 802850-802927 [+]
cgr-mir-16JH000694.1: 802988-803071 [+]
Database links

Mature sequence cgr-miR-15a-5p

Accession MIMAT0023789
Sequence

10 - 

uagcagcacauaaugguuugugga

 - 33

Get sequence
Deep sequencing48175 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-15a-3p

Accession MIMAT0023790
Sequence

47 - 

caggccauauugugcugccuca

 - 68

Get sequence
Deep sequencing15 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).