Stem-loop sequence cgr-mir-146b

AccessionMI0020408 (change log)
DescriptionCricetulus griseus miR-146b stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   ---   u   u  g        a    a    cu  ga  u 
5'    acc ggc cu agaacuga uucc uagg  gu  gc c
      ||| ||| || |||||||| |||| ||||  ||  ||  
3'    ugg ccg gg ucuugacu aggg aucc  ua  cg u
   ugu   c   u  -        c    -    cg  aa  a 
Get sequence
Deep sequencing
735739 reads, 9.48e+03 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000895.1: 588891-588969 [+]
intergenic
Database links

Mature sequence cgr-miR-146b-5p

Accession MIMAT0023775
Sequence

10 - 

ugagaacugaauuccauaggcug

 - 32

Get sequence
Deep sequencing714850 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-146b-3p

Accession MIMAT0023776
Sequence

48 - 

gcccuagggacucaguucuggu

 - 69

Get sequence
Deep sequencing2036 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).