Stem-loop sequence cgr-mir-146a

AccessionMI0020407 (change log)
DescriptionCricetulus griseus miR-146a stem-loop
Gene family MIPF0000103; mir-146
Literature search

1 open access papers mention cgr-mir-146a
(1 sentences)

Stem-loop
   -------c       cu            c        g  uc 
5'         cucagcu  gagaacugaauu cauggguu ug  a
           |||||||  |||||||||||| |||||||| ||  a
3'         gggucga  uucuugacuuga guguccag ac  u
   ucucgaua       -c            a        -  ug 
Get sequence
Deep sequencing
319961 reads, 4.05e+03 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000303.1: 1014971-1015050 [+]
intergenic
Database links

Mature sequence cgr-miR-146a

Accession MIMAT0023774
Sequence

10 - 

ugagaacugaauuccauggguu

 - 31

Get sequence
Deep sequencing298367 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).