Stem-loop sequence cgr-mir-144

AccessionMI0020406 (change log)
DescriptionCricetulus griseus miR-144 stem-loop
Gene family MIPF0000093; mir-144
Stem-loop
   ------   u      g        a         -a    gu 
5'       ccc ggcugg auaucauc uauacugua  guuu  g
         ||| |||||| |||||||| |||||||||  ||||   
3'       ggg cugauc uguaguag auaugacau  caga  a
   gcccau   u      a        -         ca    gu 
Get sequence
Deep sequencing
17545 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH001459.1: 338259-338338 [+]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-144
cgr-mir-144JH001459.1: 338259-338338 [+]
cgr-mir-451aJH001459.1: 338429-338500 [+]
Database links

Mature sequence cgr-miR-144

Accession MIMAT0023773
Sequence

10 - 

ggauaucaucauauacuguaag

 - 31

Get sequence
Deep sequencing58 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).