Stem-loop sequence cgr-mir-122

AccessionMI0020383 (change log)
DescriptionCricetulus griseus miR-122 stem-loop
Gene family MIPF0000095; mir-122
Stem-loop
   ---     -      gg       c           --u  c 
5'    agcag agcugu  aguguga aaugguguuug   gu c
      ||||| ||||||  ||||||| |||||||||||   ||  
3'    ucguc ucgaua  ucacacu uuaccgcaaac   ca a
   gga     a      aa       a           uau  a 
Get sequence
Deep sequencing
22396 reads, 33.3 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000659.1: 638593-638672 [-]
intergenic
Database links

Mature sequence cgr-miR-122

Accession MIMAT0023739
Sequence

11 - 

uggagugugacaaugguguuu

 - 31

Get sequence
Deep sequencing26 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).