Stem-loop sequence cgr-mir-106b

AccessionMI0020379 (change log)
DescriptionCricetulus griseus miR-106b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   -          -ua       g       agaua    uc u 
5'  cugcuggggc   aagugcu acagugc     gugg  c c
    ||||||||||   ||||||| |||||||     ||||  | u
3'  gacgaccucg   uucaugg ugucacg     cauc  g c
   g          ucg       g       ----c    gu u 
Get sequence
Deep sequencing
134565 reads, 1.28e+03 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH001296.1: 179099-179179 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-106b
cgr-mir-106bJH001296.1: 179099-179179 [-]
cgr-mir-93JH001296.1: 178880-178960 [-]
cgr-mir-25JH001296.1: 178664-178762 [-]
Database links

Mature sequence cgr-miR-106b-5p

Accession MIMAT0023732
Sequence

11 - 

uaaagugcugacagugcagaua

 - 32

Get sequence
Deep sequencing92188 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-106b-3p

Accession MIMAT0023733
Sequence

51 - 

ccgcacuguggguacuugcugc

 - 72

Get sequence
Deep sequencing19382 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).