Stem-loop sequence hsa-mir-6086

Accession MI0020363
Description Homo sapiens miR-6086 stem-loop
Stem-loop 
      uu   a           gag 
aggagg  ggg agggcagagau   c
||||||  ||| |||||||||||   a
uuuuuc  uuu uuccguuuuug   u
      uu   g           aaa
Get sequence
Deep sequencing
2 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 13608411-13608465 [+]
sense
OTTHUMT00000055800 ; EGFL6-002; intron 2
OTTHUMT00000055801 ; EGFL6-003; intron 2
OTTHUMT00000055800 ; EGFL6-002; intron 2
OTTHUMT00000055801 ; EGFL6-003; intron 2
ENST00000361306 ; EGFL6-002; intron 2
ENST00000380602 ; EGFL6-003; intron 2
ENST00000361306 ; EGFL6-002; intron 2
ENST00000380602 ; EGFL6-003; intron 2

Mature sequence hsa-miR-6086

Accession MIMAT0023711
Sequence

2 -  

ggagguugggaagggcagag

 - 21

Get sequence
Deep sequencing 2 reads, 2 experiments
Evidence experimental; cloned [1], qPCR [1]

References

1
PMID:22142236 "Discovery and Characterization of Novel MicroRNAs During Endothelial Differentiation of Human Embryonic Stem Cells" Yoo JK, Kim J, Choi SJ, Noh HM, Kwon YD, Yoo H, Yi HS, Chung HM, Kim JK Stem Cells Dev. [Epub prior to print](2012).