Stem-loop sequence hsa-mir-6075

Accession MI0020352
Description Homo sapiens miR-6075 stem-loop
Stem-loop 
---       c     -   cca    -  --c    -c  cca  u   gu 
   gacacca augcu ccu   ggcc ug   cugc  cu   gg cau  u
   ||||||| ||||| |||   |||| ||   ||||  ||   || |||   
   cuguggu uacgg gga   ccgg ac   gacg  ga   cc gug  c
cca       -     c   --c    c  cac    ua  cac  u   ac
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 1510877-1510971 [-]
sense
OTTHUMT00000253651 ; LPCAT1-001; intron 1
OTTHUMT00000304032 ; LPCAT1-002; intron 1
OTTHUMT00000253651 ; LPCAT1-001; intron 1
OTTHUMT00000304032 ; LPCAT1-002; intron 1
OTTHUMT00000365913 ; LPCAT1-004; intron 2
OTTHUMT00000365913 ; LPCAT1-004; intron 2
ENST00000475622 ; LPCAT1-001; intron 1
ENST00000283415 ; LPCAT1-002; intron 1
ENST00000475622 ; LPCAT1-001; intron 1
ENST00000283415 ; LPCAT1-002; intron 1
ENST00000514484 ; LPCAT1-004; intron 2
ENST00000514484 ; LPCAT1-004; intron 2

Mature sequence hsa-miR-6075

Accession MIMAT0023700
Sequence

70 -  

acggcccaggcggcauuggug

 - 90

Get sequence
Deep sequencing 2 reads, 2 experiments
Evidence experimental; SOLiD [1]

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).