Stem-loop sequence ame-mir-6048

AccessionMI0020319 (change log)
DescriptionApis mellifera miR-6048 stem-loop
Stem-loop
   u  gagg  -  -     -     ga        ga  ---uua  -    c 
5'  gu    gc ca aucag cgguc  accucguc  ug      gc ucgg g
    ||    || || ||||| |||||  ||||||||  ||      || ||||  
3'  ca    cg gu ugguc gccag  uggagcgg  ac      cg agcc u
   a  ---a  u  a     a     -g        ag  uucaag  g    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000061.5: 1909421-1909515 [-]
intergenic
Database links

Mature sequence ame-miR-6048-3p

Accession MIMAT0023672
Sequence

63 - 

agaggcgagguggaccgacuggu

 - 85

Get sequence
Evidence experimental; Illumina [1-3]

References

1
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).