Stem-loop sequence ame-mir-6012

AccessionMI0020317 (change log)
DescriptionApis mellifera miR-6012 stem-loop
Gene family MIPF0001496; mir-6012
Literature search

1 open access papers mention ame-mir-6012
(1 sentences)

Stem-loop
   g        -a          a ug  g g  gg   uggaac 
5'  gcaggguu  gcaggcugau u  uc g cg  gug      a
    ||||||||  |||||||||| |  || | ||  |||       
3'  cgucccaa  uguccgacua a  ag c gc  uac      a
   -        gc          g gu  - g  uu   ugaaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 1733943-1734027 [+]
intergenic
Database links

Mature sequence ame-miR-6012-3p

Accession MIMAT0023670
Sequence

54 - 

uucggcgaugagaucagccugu

 - 75

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).