Stem-loop sequence ame-mir-6037

AccessionMI0020304 (change log)
DescriptionApis mellifera miR-6037 stem-loop
Stem-loop
   -ua    gaag    -u   c          c    aa    au 
5'    uggu    guaa  agu cauagagcuu aaaa  uuga  c
      ||||    ||||  ||| |||||||||| ||||  ||||  g
3'    gcua    cauu  uca gugucucgaa uuuu  aauu  u
   aaa    -gga    uu   u          -    ca    cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000055.5: 7535390-7535476 [+]
intergenic
Database links

Mature sequence ame-miR-6037-3p

Accession MIMAT0023657
Sequence

57 - 

uaagcucuguguacuuuuuac

 - 77

Get sequence
Evidence experimental; Illumina [1-3]

References

1
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).