Stem-loop sequence bna-MIR6036

AccessionMI0020303 (change log)
DescriptionBrassica napus miR6036 stem-loop
Literature search

2 open access papers mention bna-MIR6036
(2 sentences)

Stem-loop
   ucaguua  --cuca      ucu     -       a      uuauuuuaua     -  g  cg  ug       -agug  gu 
5'        gc      gugguu   cgggu cuaguau uauauu          uggua ac gg  gu  uugugga     au  u
          ||      ||||||   ||||| ||||||| ||||||          ||||| || ||  ||  |||||||     ||  u
3'        cg      uacuag   guuca gaucaug auauaa          aucau ug uu  ua  aacacuu     ua  a
   ------a  uauaug      uac     u       -      ----------     a  g  ag  gu       aagaa  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189214: 37840-37994 [-]
intergenic
Database links

Mature sequence bna-miR6036

Accession MIMAT0023656
Sequence

122 - 

auaguacuaguacuugcaugauca

 - 145

Get sequence
Evidence experimental; Illumina [1]

References

1