Stem-loop sequence bna-MIR6035

AccessionMI0020302 (change log)
DescriptionBrassica napus miR6035 stem-loop
Literature search

2 open access papers mention bna-MIR6035
(2 sentences)

Stem-loop
   aaacugca         a       c              ugcauuuu 
5'         aaauggagu gaaaaug agucgugaacaaac        c
           ||||||||| ||||||| ||||||||||||||        c
3'         uuuaccuca cuuuuac ucaguauuuguuug        a
   --------         c       a              uuuaccuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189440: 135610-135700 [+]
intergenic
Database links

Mature sequence bna-miR6035

Accession MIMAT0023655
Sequence

12 - 

uggaguagaaaaugcagucgu

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1