Stem-loop sequence bna-MIR6034

AccessionMI0020301 (change log)
DescriptionBrassica napus miR6034 stem-loop
Literature search

2 open access papers mention bna-MIR6034
(2 sentences)

Stem-loop
            c                        c         u g             ua 
5' auauacucu aagcauaucaacuccgaagcuaua acaucggau u uccgacauuguau  g
   ||||||||| |||||||||||||||||||||||| ||||||||| | |||||||||||||  a
3' uauaugaga uucguauaguugggguuucgauau uguagucua a agguuguaacaua  c
            a                        a         c g             ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BH421046: 416-542 [-]
intergenic
EM:BZ504827: 134-260 [-]
intergenic
Database links

Mature sequence bna-miR6034

Accession MIMAT0023654
Sequence

85 - 

ucugauguauauagcuuuggg

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1