Stem-loop sequence bna-MIR6033

AccessionMI0020300 (change log)
DescriptionBrassica napus miR6033 stem-loop
Stem-loop
   gaggau                 g  g      u        -a   cuc        
5'       ucucucaagucccacuc gu ugguuc uaggaacg  acc   uaacugu 
         ||||||||||||||||| || |||||| ||||||||  |||   |||||| u
3'       agagaguucagggugag ua accaag auccuugc  ugg   auugaca 
   -ugggu                 a  g      u        ag   ---        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC137927: 57666-57775 [+]
intergenic
EM:AC172878: 21272-21381 [+]
intergenic
Database links

Mature sequence bna-miR6033

Accession MIMAT0023653
Sequence

78 - 

ugaaccagauagagugggacu

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1