Stem-loop sequence bna-MIR6032

AccessionMI0020299 (change log)
DescriptionBrassica napus miR6032 stem-loop
Gene family MIPF0002003; MIR6032
Literature search

1 open access papers mention bna-MIR6032
(1 sentences)

Stem-loop
   u     u    u          -    a        g   --  ug   ga 
5'  uauuu guuu aacauggagc auca cagaucuc gag  ca  uaa  u
    ||||| |||| |||||||||| |||| |||||||| |||  ||  |||   
3'  auaaa caaa uuguaccuug uggu gucuaggg cuc  gu  guu  c
   a     u    -          c    c        g   cu  uu   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189188: 93338-93437 [+]
intergenic
Database links

Mature sequence bna-miR6032

Accession MIMAT0023652
Sequence

17 - 

uggagcaucaacagaucucgg

 - 37

Get sequence
Evidence experimental; Illumina [1]

References

1