Stem-loop sequence bna-MIR6031

AccessionMI0020298 (change log)
DescriptionBrassica napus miR6031 stem-loop
Literature search

1 open access papers mention bna-MIR6031
(11 sentences)

Stem-loop
   ua  a    c g    g            -     c 
5'   ag gguu g agcg uuugaagcgauu uauag g
     || |||| | |||| |||||||||||| |||||  
3'   uc ccaa u ucgc aagcuuuguuag auguu g
   --  g    c g    a            u     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189275: 4339-4409 [-]
intergenic
Database links

Mature sequence bna-miR6031

Accession MIMAT0023651
Sequence

2 - 

aagagguucggagcgguuugaagc

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1