Stem-loop sequence bna-MIR6030

AccessionMI0020297 (change log)
DescriptionBrassica napus miR6030 stem-loop
Literature search

1 open access papers mention bna-MIR6030
(1 sentences)

Stem-loop
   uca         u         -      cu   u   ca  a        uuuac 
5'    gggauuaag gucuguaug uguggg  gag agg  ca ucacagcu     u
      ||||||||| ||||||||| ||||||  ||| |||  || ||||||||     c
3'    uccuaauuc cagacauac auaccc  cuc ucc  gu aguguugg     a
   -ag         c         c      ac   u   ag  a        ucuag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189357: 62324-62436 [-]
intergenic
Database links

Mature sequence bna-miR6030

Accession MIMAT0023650
Sequence

82 - 

uccacccauaccauacagaccc

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1