Stem-loop sequence bna-MIR6029

AccessionMI0020296 (change log)
DescriptionBrassica napus miR6029 stem-loop
Literature search

1 open access papers mention bna-MIR6029
(1 sentences)

Stem-loop
   aag                   c    aa            g         --c    gg 
5'    agauacacaagccaagccu aaau  acaaucccaaca auuacaaau   auuu  c
      ||||||||||||||||||| ||||  |||||||||||| |||||||||   ||||   
3'    ucuauguguucgguucgga uuua  uguugggguugu uaauguuua   uaag  c
   ---                   c    -g            a         cuu    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189547: 50957-51072 [-]
intergenic
Database links

Mature sequence bna-miR6029

Accession MIMAT0023649
Sequence

83 - 

ugggguugugauuucaggcuu

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1