Stem-loop sequence bna-MIR6028

AccessionMI0020295 (change log)
DescriptionBrassica napus miR6028 stem-loop
Literature search

1 open access papers mention bna-MIR6028
(1 sentences)

Stem-loop
   acaagcac   u gga          u            a  u  g       uggu    uaa  uuu 
5'         ggu g   ugauggagag aaggacauucag uc gc aagcuua    cccg   cu   a
           ||| |   |||||||||| |||||||||||| || || |||||||    ||||   ||    
3'         ccg c   acuacuucuc uuucuguaaguc ag ug uuugagu    gggu   gg   a
   ------cu   u aaa          -            c  u  -       uugu    -ua  uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bna-miR6028

Accession MIMAT0023648
Sequence

20 - 

uggagaguaaggacauucaga

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1