Stem-loop sequence bna-MIR2111c

AccessionMI0020294 (change log)
DescriptionBrassica napus miR2111c stem-loop
Gene family MIPF0000754; MIR2111
Literature search

3 open access papers mention bna-MIR2111c
(3 sentences)

Stem-loop
   -uauug       cc                        --c g    ag        ---aa      g 
5'       gugagga  ggguaaucugcauccugggguuua   g uuua  aacacaca     gugugc u
         |||||||  ||||||||||||||||||||||||   | ||||  ||||||||     ||||||  
3'       cauuccu  uccauuaggcguaggacuccagau   c aaau  uugugugu     uauacg a
   gcauaa       uc                        uuu g    ga        auaug      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BH979745: 325-460 [-]
intergenic
Database links

Mature sequence bna-miR2111c

Accession MIMAT0023647
Sequence

18 - 

uaaucugcauccugggguuua

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1