Stem-loop sequence bna-MIR2111d

AccessionMI0020293 (change log)
DescriptionBrassica napus miR2111d stem-loop
Gene family MIPF0000754; MIR2111
Literature search

3 open access papers mention bna-MIR2111d
(3 sentences)

Stem-loop
   -    a   cu         c         u       u     g  aauuaaa    g 
5'  guga gaa  gguaaucug auccugagg uuaaaaa uuaua gc       acau c
    |||| |||  ||||||||| ||||||||| ||||||| ||||| ||       ||||  
3'  cauu cuu  ccauuaggc uagggcucc aauuuuu gguau ug       ugua a
   u    c   cu         a         u       u     g  -------    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189646: 4110-4221 [+]
intergenic
Database links

Mature sequence bna-miR2111d

Accession MIMAT0023646
Sequence

13 - 

uaaucugcauccugagguuua

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1